Search
Category : Keyword :


PROTEIN
MGSYPDGFPGSMDELDFNKDFDLPPSSNQTLGLANGFYLDDLDFSSLDPPEAYPSQNNNNNNINNKAVAGDLLSSSSDDADFSDSVLKYISQVLMEEDMEEKPCMFHDALALQAAEKSLYEALGEKYPSSSSASSVDHPERLASDSPDGSCSGGAFSDYASTTTTTSSDSHWSVDGLENRPSWLHTPMPSNFVFQSTSRSNSVTGGGGGGNSAVYGSGFGDDLVSNMFKDDELAMQFKKGVEEASKFLPKSSQLFIDVDSYIPMNSGSKENGSEVFVKTEKKDETEHHHHHSYAPPPNRLTGKKSHWRDEDEDFVEERSNKQSAVYVEESELSEMFDKILVCGPGKPVCILNQNFPTESAKVVTAQSNGAKIRGKKSTSTSHSNDSKKETADLRTLLVLCAQAVSVDDRRTANEMLRQIREHSSPLGNGSERLAHYFANSLEARLAGTGTQIYTALSSKKTSAADMLKAYQTYMSVCPFKKAAIIFANHSMMRFTANANTIHIIDFGISYGFQWPALIHRLSLSRPGGSPKLRITGIELPQRGFRPAEGVQETGHRLARYCQRHNVPFEYNAIAQKWETIQVEDLKLRQGEYVVVNSLFRFRNLLDETVLVNSPRDAVLKLIRKINPNVFIPAILSGNYNAPFFVTRFREALFHYSAVFDMCDSKLAREDEMRLMYEKEFYGREIVNVVACEGTERVERPETYKQWQARLIRAGFRQLPLEKELMQNLKLKIENGYDKNFDVDQNGNWLLQGWKGRIVYASSLWVPSSS
NUCLEOTIDE
ATGGGTTCTTATCCGGATGGATTCCCTGGATCCATGGACGAGTTGGATTTCAATAAGGACTTTGATTTGCCTCCCTCCTCAAACCAAACCTTAGGTTTAGCTAATGGGTTCTATTTAGATGACTTAGATTTCTCATCCTTGGATCCTCCAGAGGCATATCCCTCCCAGAACAACAACAACAACAACATCAACAACAAAGCTGTAGCAGGAGATCTGTTATCATCTTCATCTGATGACGCTGATTTCTCTGATTCTGTTTTGAAGTATATAAGCCAAGTTCTTATGGAAGAGGATATGGAAGAGAAGCCTTGTATGTTTCATGACGCTTTGGCTCTTCAAGCTGCTGAGAAATCTCTCTATGAGGCTCTTGGTGAGAAATACCCTTCTTCGTCTTCTGCTTCTTCTGTGGATCATCCTGAGAGATTGGCTAGTGATAGCCCTGACGGTTCTTGTTCAGGTGGTGCTTTTAGTGATTACGCTAGCACCACTACCACTACTTCCTCTGATTCTCACTGGAGTGTTGATGGTTTGGAGAATAGACCTTCTTGGTTACATACACCTATGCCGAGTAATTTTGTTTTCCAGTCTACTTCTAGGTCCAACAGTGTCACCGGTGGTGGTGGTGGTGGTAATAGTGCGGTTTACGGTTCAGGTTTTGGCGATGATTTGGTTTCGAATATGTTTAAAGATGATGAATTGGCTATGCAGTTCAAGAAAGGGGTTGAGGAAGCTAGTAAGTTCCTTCCTAAGTCTTCTCAGCTCTTTATTGATGTGGATAGTTACATCCCTATGAATTCTGGTTCCAAGGAAAATGGTTCTGAGGTTTTTGTTAAGACGGAGAAGAAAGATGAGACAGAGCATCATCATCATCATAGCTATGCTCCTCCTCCCAACAGATTAACTGGTAAGAAAAGCCATTGGCGCGACGAAGATGAAGATTTCGTTGAAGAAAGAAGTAACAAGCAATCAGCTGTTTATGTTGAGGAAAGCGAGCTTTCTGAAATGTTTGATAAGATCTTGGTATGTGGCCCTGGGAAACCTGTATGCATTCTTAACCAGAACTTTCCTACAGAATCCGCTAAAGTCGTGACCGCACAGTCAAATGGAGCAAAGATTCGTGGGAAGAAATCAACTTCTACTAGTCATAGTAACGATTCTAAGAAAGAAACTGCTGATTTGAGGACTCTTTTGGTGTTATGTGCACAAGCTGTATCAGTGGATGATCGTAGAACCGCCAACGAAATGCTAAGGCAGATACGAGAGCATTCTTCGCCTCTAGGCAATGGTTCAGAGCGGTTGGCTCATTATTTTGCAAATAGTCTTGAAGCACGCTTAGCTGGGACCGGTACACAGATCTACACCGCTTTATCTTCGAAGAAAACGTCTGCAGCAGACATGTTGAAGGCTTACCAGACATACATGTCGGTCTGCCCTTTCAAGAAAGCTGCTATCATATTTGCTAACCACAGCATGATGCGTTTCACTGCAAACGCCAACACGATCCACATAATAGATTTCGGAATATCTTACGGTTTTCAGTGGCCTGCTCTGATTCATCGCCTCTCGCTCAGCAGACCTGGTGGTTCGCCTAAGCTTCGAATTACCGGTATAGAGCTTCCTCAGCGCGGTTTTAGACCAGCGGAAGGAGTTCAGGAGACAGGTCATCGCTTGGCTCGATACTGTCAGCGACACAATGTTCCGTTTGAGTACAACGCAATTGCTCAGAAATGGGAAACGATCCAAGTCGAAGACTTAAAGCTTCGACAAGGAGAGTATGTGGTTGTGAACTCTTTGTTCCGTTTCAGGAACCTTCTAGATGAGACCGTTCTGGTAAACAGCCCGAGAGATGCAGTTTTGAAGCTGATAAGAAAAATAAACCCGAATGTCTTCATTCCAGCGATCTTAAGCGGGAATTACAACGCGCCATTCTTTGTCACGAGGTTCAGAGAAGCGTTGTTTCATTACTCGGCTGTGTTTGATATGTGTGACTCGAAGCTAGCTAGGGAAGACGAGATGAGGCTGATGTATGAGAAAGAGTTTTATGGGAGAGAGATTGTGAATGTTGTGGCTTGTGAAGGAACAGAGAGAGTGGAGAGACCAGAGACATATAAGCAGTGGCAGGCGAGACTGATCCGAGCCGGATTTAGACAGCTTCCGCTTGAGAAGGAACTGATGCAGAATCTGAAGTTGAAAATCGAAAACGGGTACGATAAAAACTTCGATGTTGATCAAAACGGTAACTGGTTACTTCAAGGGTGGAAAGGTAGAATCGTGTATGCTTCATCTCTATGGGTTCCTTCGTCTTCATAG